produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
password generator

Password generator technologies used What is? It is Password generator How to Download? Download on releases Clone repo git clone https://github.com/m

1 Dec 16, 2021
We provide useful util functions. When adding a util function, please add a description of the util function.

Utils Collection Motivation When we implement codes, we often search for util functions that are already implemented. Here, we are going to share util

6 Sep 09, 2021
glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

gle_ip_info glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

Fatin Shadab 3 Nov 21, 2021
A fixture that allows runtime xfail

pytest-runtime-xfail pytest plugin, providing a runtime_xfail fixture, which is callable as runtime_xfail(), to allow runtime decisions to mark a test

Brian Okken 4 Apr 06, 2022
EVE-NG tools, A Utility to make operations with EVE-NG more friendly.

EVE-NG tools, A Utility to make operations with EVE-NG more friendly. Also it support different snapshot operations with same style as Libvirt/KVM

Bassem Aly 8 Jan 05, 2023
A simple toolchain for moving Remarkable highlights to Readwise

A simple toolchain for moving Remarkable highlights to Readwise

zach wick 20 Dec 20, 2022
Implicit hierarchical a posteriori error estimates in FEniCSx

FEniCSx Error Estimation (FEniCSx-EE) Description FEniCSx-EE is an open source library showing how various error estimation strategies can be implemen

Jack S. Hale 1 Dec 08, 2021
Know your customer pipeline in apache air flow

KYC_pipline Know your customer pipeline in apache air flow For a successful pipeline run take these steps: Run you Airflow server Admin - connection

saeed 4 Aug 01, 2022
Display your calendar on the wallpaper.

wallCal Have your calendar appear as the wallpaper. disclaimer Use at your own risk. Don't blame me if you miss a meeting :-) Some parts of the script

7 Jun 14, 2022
Create a Web Component (a Custom Element) from a python file

wyc Create a Web Component (a Custom Element) from a python file (transpile python code to javascript (es2015)). Features Use python to define your cu

7 Oct 09, 2022
Python Random Number Genrator

This Genrates Random Numbers. This Random Number Generator was made using python. This software uses Time and Random extension. Download the EXE file and run it to get your answer.

Krish Sethi 2 Feb 03, 2022
extract gene TSS/TES site form gencode/ensembl/gencode database GTF file and export bed format file.

GetTsite python Package extract gene TSS/TES site form gencode/ensembl/gencode database GTF file and export bed format file. Install $ pip install Get

laojunjun 7 Nov 21, 2022
A Randomizer Oracle

Tezos Randomizer Tezod Randomizer "Oracle". It's a smart contract that you can call to get a random number between X and Y (for now). It uses entropy

Asbjorn Enge 19 Sep 13, 2022
A utility that makes it easy to work with Python projects containing lots of packages, of which you only want to develop some.

Mixed development source packages on top of stable constraints using pip mxdev [mɪks dɛv] is a utility that makes it easy to work with Python projects

BlueDynamics Alliance 6 Jun 08, 2022
These scripts look for non-printable unicode characters in all text files in a source tree

find-unicode-control These scripts look for non-printable unicode characters in all text files in a source tree. find_unicode_control.py should work w

Siddhesh Poyarekar 25 Aug 30, 2022
Brainfuck rollup scaling experiment for fun

Optimistic Brainfuck Ever wanted to run Brainfuck on ethereum? Don't ask, now you can! And at a fraction of the cost, thanks to optimistic rollup tech

Diederik Loerakker 48 Dec 28, 2022
A tool to create the basics of a project

Project-Scheduler Instalação Para instalar o Project Maker, você necessita está em um ambiente de desenvolvimento Linux ou wsl com alguma distro debia

2 Dec 17, 2021
This is a python table of data implementation with styles, colors

Table This is a python table of data implementation with styles, colors Example Table adapts to the lack of data Lambda color features Full power of l

Урядов Алексей 5 Nov 09, 2021
Random Number Generator

Application for generating a random number.

Michael J Bailey 1 Oct 12, 2021
MITRE ATT&CK Lookup Tool

MITRE ATT&CK Lookup Tool attack-lookup is a tool that lets you easily check what Tactic, Technique, or Sub-technique ID maps to what name, and vice ve

Curated Intel 33 Nov 22, 2022