Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Related tags

File & Path UtilitiesGetTransTool
Overview

GetTransTool Package

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file.

  • 1.Extract longest transcript from gencode transcripts fasta file.

  • 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

  • 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

  • 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

Install

$ pip install GetTransTool

Usage

1. get longest transcript from gencode transcripts fasta file:

help infomation:

$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa

Get longest transcripts from gencode transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!

there will be three files produced including name_changed.fa, longest_transcripts_info.csv, longest_trans_gencode.fa.

name_changed.fa:

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

longest_transcripts_info.csv:

this is the longest transcripts exon length information.

fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1_ENSMUST00020182568.1_35,snoZ196,35
snoZ159_ENSMUSG00002075734.1_ENSMUST00020182611.1_87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1_ENSMUST00000240071.1_119,n-R5s93,119
...

longest_trans_gencode.fa:

this is the filtered longest transcript fasta file.

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:

help infomation:

$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans.fa

Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 159.51 seconds!

there will be three files produced including longest_transcripts_info.csv, longest_trans.gtf, longest_trans_ensembl.fa.

longest_transcripts_info.csv:

,transcript_length,gene_name
snoZ196_ENSG00000281780_ENST00000625269_snoRNA,89,snoZ196
hsa-mir-423_ENSG00000266919_ENST00000586878_lncRNA,94,hsa-mir-423
hsa-mir-1253_ENSG00000272920_ENST00000609567_lncRNA,105,hsa-mir-1253
...

longest_trans.gtf:

this is the gtf information for the longest transcripts.

1	havana	gene	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1	havana	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1	havana	exon	11869	12227	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	12613	12721	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003582793"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	13221	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "3"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002312635"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	gene	14404	29570	.	-	.	gene_id "ENSG00000227232"; gene_version "5"; gene_name "WASH7P"; gene_source "havana"; gene_biotype "unprocessed_pseudogene";

longest_trans_ensembl.fa:

>DDX11L1_ENSG00000223972_ENST00000456328_transcribed_unprocessed_pseudogene
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTC
TCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGA
TGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTG
...

for ucsc:

$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_trans_ucsc.fa

3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

help infomation:

$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done! 
Running with 17.67 seconds!

there will be four files produced including name_changed.fa, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_gencode.fa.

name_changed.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_transcripts_info.csv:

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_trans_gencode.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

help infomation:

$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o cdslongestfile, --outfile cdslongestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGTF  --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 152.38 seconds!

there will be four files produced including CDS_longest_trans.gtf, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_ensembl.fa.

CDS_longest_trans.gtf:

1	ensembl_havana	gene	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1	havana	transcript	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003812156"; exon_version "1"; tag "basic";
1	havana	exon	65520	65573	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813641"; exon_version "1"; tag "basic";
1	havana	CDS	65565	65573	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	start_codon	65565	65567	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	69037	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813949"; exon_version "1"; tag "basic";
1	havana	CDS	69037	70005	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	stop_codon	70006	70008	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65520	65564	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	three_prime_utr	70009	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	ensembl_havana	gene	450740	451678	.	-	.	gene_id "ENSG00000284733"; gene_version "2"; gene_name "OR4F29"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
1227,ZZZ3_ENSG00000036549_ENST00000370798,2468,486,ZZZ3
173,ZZZ3_ENSG00000036549_ENST00000433749,603,430,ZZZ3
...

longest_cds_transcripts_info.csv:

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
8883,ZZEF1_ENSG00000074755_ENST00000381638,11466,135,ZZEF1
1716,ZYX_ENSG00000159840_ENST00000322764,2228,80,ZYX
...

longest_cds_trans_gencode.fa:

>OR4F5_ENSG00000186092_ENST00000641515_61_1038_2618
CCCAGATCTCTTCAGTTTTTATGCCTCATTCTGTGAAAATTGCTGTAGTCTCTTCCAGTT
ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAAC
TCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTC
...

for ucsc:

$ GetCDSLongestFromGTF  --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa

END

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

Owner
laojunjun
路漫漫其修远兮 吾将上下而求索
laojunjun
GitHub Repository
Publicly Open Amazon AWS S3 Bucket Viewer

S3Viewer Publicly open storage viewer (Amazon S3 Bucket, Azure Blob, FTP server, HTTP Index Of/) s3viewer is a free tool for security researchers that

Sharon Brizinov 377 Dec 02, 2022
Find potentially sensitive files

find_files Find potentially sensitive files This script searchs for potentially sensitive files based off of file name or string contained in the file

4 Aug 20, 2022
A file utility for accessing both local and remote files through a unified interface.

A file utility for accessing both local and remote files through a unified interface.

AI2 19 Nov 16, 2022
organize - The file management automation tool

organize - The file management automation tool

Thomas Feldmann 1.5k Jan 01, 2023
dotsend is a web application which helps you to upload your large files and share file via link

dotsend is a web application which helps you to upload your large files and share file via link

Devocoe 0 Dec 03, 2022
A Python script to backup your favorite Discord gifs

About the project Discord recently felt like it would be a good idea to limit the favorites to 250, which made me lose most of my gifs... Luckily for

4 Aug 03, 2022
Python Sreamlit Duplicate Records Finder Remover

Python-Sreamlit-Duplicate-Records-Finder-Remover Streamlit is an open-source Python library that makes it easy to create and share beautiful, custom w

RONALD KANYEPI 1 Jan 21, 2022
An object-oriented approach to Python file/directory operations.

Unipath An object-oriented approach to file/directory operations Version: 1.1 Home page: https://github.com/mikeorr/Unipath Docs: https://github.com/m

Mike Orr 506 Dec 29, 2022
Creates folders into a directory to categorize files in that directory by file extensions and move all things from sub-directories to current directory.

Categorize and Uncategorize Your Folders Table of Content TL;DR just take me to how to install. What are Extension Categorizer and Folder Dumper Insta

Furkan Baytekin 1 Oct 17, 2021
Test app for importing contact information in CSV files.

Contact Import TestApp Test app for importing contact information in CSV files. Explore the docs » · Report Bug · Request Feature Table of Contents Ab

1 Feb 06, 2022
Python virtual filesystem for SQLite to read from and write to S3

Python virtual filesystem for SQLite to read from and write to S3

Department for International Trade 70 Jan 04, 2023
Yadl - it is a simple library for working with both dotenv files and environment variables.

Yadl Yadl - it is a simple library for working with both dotenv files and environment variables. Features Validation of whitespaces. Validation of num

Ivan Kapranov 3 Oct 19, 2021
Instant Fuzzy File Search for Alfred

List all the files inside a folder using fd, and instantly fuzzy-search through all of them using fzf, all from inside Alfred with a single keyword: fzf.

Mr. Pennyworth 37 Nov 30, 2022
Utils for streaming large files (S3, HDFS, gzip, bz2...)

smart_open — utils for streaming large files in Python What? smart_open is a Python 3 library for efficient streaming of very large files from/to stor

RARE Technologies 2.7k Jan 06, 2023
Copy only text-like files from the folder

copy-only-text-like-files-from-folder-python copy only text-like files from the folder This project is for those who want to copy only source code or

1 May 17, 2022
Extract an archive file (zip file or tar file) stored on AWS S3

S3 Extract Extract an archive file (zip file or tar file) stored on AWS S3. Details Downloads archive from S3 into memory, then extract and re-upload

Evan 1 Dec 14, 2021
Object-oriented file system path manipulation

path (aka path pie, formerly path.py) implements path objects as first-class entities, allowing common operations on files to be invoked on those path

Jason R. Coombs 1k Dec 28, 2022
Here is some Python code that allows you to read in SVG files and approximate their paths using a Fourier series.

Here is some Python code that allows you to read in SVG files and approximate their paths using a Fourier series. The Fourier series can be animated and visualized, the function can be output as a tw

Alexander 12 Jan 01, 2023
ValveVMF - A python library to parse Valve's VMF files

ValveVMF ValveVMF is a Python library for parsing .vmf files for the Source Engi

pySourceSDK 2 Jan 02, 2022
Provides a convenient way to append numpy arrays to a file.

Provides a convenient way to append numpy arrays to a file. The NpendWriter and NpendReader classes are used to write and read numpy arrays respective

3 May 14, 2022