Python codecs extension featuring CLI tools for encoding/decoding anything

Related tags

Command-line Toolspythonencodingcryptographydecoderdnamorsebase58codecbraillebase62ctfencodingsbaseleetspeakctf-toolsbase36encoder-decodercodecsbase100base45
Overview

CodExt Tweet

Encode/decode anything.

PyPi Read The Docs Build Status Coverage Status Python Versions Requirements Status Known Vulnerabilities DOI License

This library extends the native codecs library (namely for adding new custom encodings and character mappings) and provides a myriad of new encodings (static or parametrized, like rot or xor), hence its named combining CODecs EXTension.

$ pip install codext
Want to contribute a new codec ? Want to contribute a new macro ?
Check the documentation first
Then PR your new codec		 PR your updated version of macros.json

πŸ” Demonstrations

Using CodExt from the command line

Using base tools from the command line

Using the debase command line tool

πŸ’» Usage (main CLI tool) Tweet on codext

$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
β žβ ‘β Žβ ž

$ echo -en "test" | codext encode base100
πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«

Chaining codecs

$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string

Using macros

$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

πŸ’» Usage (base CLI tool) Tweet on debase

$ echo "Test string !" | base122
*.7!ft9οΏ½-f9Γ‚

$ echo "Test string !" | base91 
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -f Test
Test string !

πŸ’» Usage (Python)

Getting the list of available codecs:

>> codext.encode("this is a test", "base58-ripple") 'jo9rA2LQwr44eBmZK7E' >>> codext.encode("this is a test", "base58-url") 'JN91Wzkpa1nnDbLyjtf' >>> codecs.encode("this is a test", "base100") 'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«' >>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100") 'this is a test' >>> for i in range(8): print(codext.encode("this is a test", "dna-%d" % (i + 1))) GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT >>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1") 'this is a test' >>> codecs.encode("this is a test", "morse") '- .... .. ... / .. ... / .- / - . ... -' >>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse") 'this is a test' >>> with open("morse.txt", 'w', encoding="morse") as f: f.write("this is a test") 14 >>> with open("morse.txt",encoding="morse") as f: f.read() 'this is a test' >>> codext.decode(""" = X : x n r y Y y p a ` n | a o h ` g o z """, "whitespace-after+before") 'CSC{not_so_invisible}' >>> print(codext.encode("An example test string", "baudot-tape")) ***.** . * ***.* * . .* * .* . * ** .* ***.** ** .** .* * . * *. * .* * *. * *. * * . * *. * *. * ***. *.* ***.* * .* "> 
>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«'

>>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100")
'this is a test'

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
	f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
	f.read()
'this is a test'

>>> codext.decode("""
      =            
              X         
   :            
      x         
  n  
    r 
        y   
      Y            
              y        
     p    
         a       
 `          
            n            
          |    
  a          
o    
       h        
          `            
          g               
           o 
   z      """, "whitespace-after+before")
'CSC{not_so_invisible}'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
   . *
***.* 
*  .  
   .* 
*  .* 
   . *
** .* 
***.**
** .**
   .* 
*  .  
* *. *
   .* 
* *.  
* *. *
*  .  
* *.  
* *. *
***.  
  *.* 
***.* 
 * .*

πŸ“ƒ List of codecs

BaseXX

  • ascii85: classical ASCII85 (Python3 only)
  • baseN: see base encodings (incl base32, 36, 45, 58, 62, 63, 64, 91, 100, 122)
  • base-genericN: see base encodings ; supports any possible base

Binary

  • baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
  • baudot-spaced: variant of baudot ; groups of 5 bits are whitespace-separated
  • baudot-tape: variant of baudot ; outputs a string that looks like a perforated tape
  • bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals
  • bcd-extended0: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 0000
  • bcd-extended1: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 1111
  • excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
  • gray: aka reflected binary code
  • manchester: XORes each bit of the input with 01
  • manchester-inverted: variant of manchester ; XORes each bit of the input with 10
  • rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)

Common

  • a1z26: keeps words whitespace-separated and uses a custom character separator
  • cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
  • dummy: set of simple encodings (including reverse and word-reverse)
  • octal: dummy octal conversion (converts to 3-digits groups)
  • octal-spaced: variant of octal ; dummy octal conversion, handling whitespace separators
  • ordinal: dummy character ordinals conversion (converts to 3-digits groups)
  • ordinal-spaced: variant of ordinal ; dummy character ordinals conversion, handling whitespace separators

Compression

  • gzip: standard Gzip compression/decompression
  • lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977
  • lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978
  • pkzip_deflate: standard Zip-deflate compression/decompression
  • pkzip_bzip2: standard BZip2 compression/decompression
  • pkzip_lzma: standard LZMA compression/decompression

Cryptography

  • affine: aka Affine Cipher
  • atbash: aka Atbash Cipher
  • bacon: aka Baconian Cipher
  • barbie-N: aka Barbie Typewriter (N belongs to [1, 4])
  • citrix: aka Citrix CTX1 passord encoding
  • rotN: aka Caesar cipher (N belongs to [1,25])
  • scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[)
  • shiftN: shift ordinals (N belongs to [1,255])
  • xorN: XOR with a single byte (N belongs to [1,255])

Languages

  • braille: well-known braille language (Python 3 only)
  • ipsum: aka lorem ipsum
  • leetspeak: based on minimalistic elite speaking rules
  • morse: uses whitespace as a separator
  • navajo: only handles letters (not full words from the Navajo dictionary)
  • radio: aka NATO or radio phonetic alphabet
  • southpark: converts letters to Kenny's language from Southpark (whitespace is also handled)
  • southpark-icase: case insensitive variant of southpark
  • tomtom: similar to morse, using slashes and backslashes

Others

  • dna: implements the 8 rules of DNA sequences (N belongs to [1,8])
  • html: implements entities according to this reference
  • letter-indices: encodes consonants and/or vowels with their corresponding indices
  • markdown: unidirectional encoding from Markdown to HTML
  • url: aka URL encoding

Steganography

  • klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution
  • resistor: aka resistor color codes
  • sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding
  • whitespace: replaces bits with whitespaces and tabs
  • whitespace_after_before: variant of whitespace ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")

πŸ‘ Supporters

Stargazers repo roster for @dhondta/python-codext

Forkers repo roster for @dhondta/python-codext

Back to top

Comments
  • using Codext guess / Codext rank gives an error

    using Codext guess / Codext rank gives an error

    When I run it on linux and try to use "codext guess" or "codext rank" I get an error message saying:

    # echo "3yZe7d" | codext rank
Traceback (most recent call last):
  File "/usr/local/bin/codext", line 8, in <module>
    sys.exit(main())
  File "/usr/local/lib/python3.9/dist-packages/codext/__init__.py", line 184, in main
    args.include, args.exclude = __format_list(args.include), __format_list(args.exclude, False)
AttributeError: 'Namespace' object has no attribute 'include'
    opened by GitSunburn 1
  • UU decoding raises an exception in some cases

    UU decoding raises an exception in some cases 

    # cat raw.txt 
1Oh6axLwfecHErbVpRbtNj8t5JACsSQrofdnnMdQtBmoU8cQj6EyLcVRsQLz1MyWfXbqQDIc9wGyyBuH7uV95lBVpFGn3syGIw0IVLx8wJr4ABsIH9Q71hBH4AvIgljx7XnfjfmafahBNrPMDkK3dsJF0r41nzyMnOf7l36NcllAOgRLoB6Qh0APotZu6plYpkSiRCAkDKowOFm0mybKp336TAJe4JiDecD9hNbl5fBDLkGNYhmSkzOQzLBH1aPumW4o

# codext -i raw.txt decode base62
begin 666 <data>
M'XL( /H^)V("__-)SBB-<O7*+#;,K8PL\/ H\C#UR2LP= H)[email protected]\*"[email protected]
M\"T-\*@(#\]V\<A,*R^W\"@I,W9Q-,LU\8XR=$XM*TYR3PG,2G)+RO P#_'.
?"LRJS#)US0X(KPJH<[email protected](<TGR  #3A(K<90      
 
end

# codext -i raw.txt decode base62 | codext decode UU
Traceback (most recent call last):
  File "/usr/lib/python3.8/encodings/uu_codec.py", line 58, in uu_decode
    data = binascii.a2b_uu(s)
binascii.Error: Illegal char

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/jeane/.local/bin/codext", line 8, in <module>
    sys.exit(main())
  File "/home/jeane/.local/lib/python3.8/site-packages/codext/__init__.py", line 124, in main
    c = getattr(codecs, ["encode", "decode"][args.command == "decode"])(c, encoding, args.errors)
  File "/home/jeane/.local/lib/python3.8/site-packages/codext/__common__.py", line 691, in decode
    return lookup(encoding).decode(obj, errors)[0]
  File "/usr/lib/python3.8/encodings/uu_codec.py", line 62, in uu_decode
    data = binascii.a2b_uu(s[:nbytes])
binascii.Error: Illegal char
    opened by RomainJennes 1
  • Implement Rail Fence Cipher

    Implement Rail Fence Cipher

    Tests pass.

    RegEx might need a fix : rail-5-3- is recognized as a valid codec (ending dash is too much). Only rail-5-3 or rail-5-3-up should be recognized. Couldn't manage to get that right.

    When encoding, there might be trailing whitespaces (which is normal), but users might forget one when copy/pasting. I left them invisible to ease the integration with other tools.

    opened by smarbal 0
  • Add tap/knock language

    Add tap/knock language

    Tap encoding and decoding is implemented and added to the documentation. Couldn't make it work with add_map() due to problems with letter and word separations (single space/double space). Did my own encoding/decoding functions instead.

    opened by smarbal 0
  • [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    Snyk has created this PR to fix one or more vulnerable packages in the `pip` dependencies of this project.

    Changes included in this PR

    • Changes to the following files to upgrade the vulnerable dependencies to a fixed version:
      • requirements.txt

    Vulnerabilities that will be fixed

    By pinning:

    Severity | Priority Score (*) | Issue | Upgrade | Breaking Change | Exploit Maturity :-------------------------:|-------------------------|:-------------------------|:-------------------------|:-------------------------|:------------------------- high severity | 768/1000
    Why? Proof of Concept exploit, Recently disclosed, Has a fix available, CVSS 7.5 | Regular Expression Denial of Service (ReDoS)
    SNYK-PYTHON-MARKDOWN2-1063233 | markdown2:
    2.3.10 -> 2.4.0
    | No | Proof of Concept

    (*) Note that the real score may have changed since the PR was raised.

    Some vulnerabilities couldn't be fully fixed and so Snyk will still find them when the project is tested again. This may be because the vulnerability existed within more than one direct dependency, but not all of the effected dependencies could be upgraded.

    Check the changes in this PR to ensure they won't cause issues with your project.

    Note: You are seeing this because you or someone else with access to this repository has authorized Snyk to open fix PRs.

    For more information: 🧐 View latest project report

    πŸ›  Adjust project settings

    πŸ“š Read more about Snyk's upgrade and patch logic

    opened by dhondta 0
  • pip 22.3 / python 3.10 warning on install

    pip 22.3 / python 3.10 warning on install

    Looks like there's a warning on the installation method via pip:

    pip install codext         
Collecting codext
  Downloading codext-1.14.0.tar.gz (116 kB)
     ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 116.2/116.2 kB 1.7 MB/s eta 0:00:00
  Preparing metadata (setup.py) ... done
Requirement already satisfied: six in ./venv/lib/python3.10/site-packages (from codext) (1.16.0)
Collecting markdown2>=2.4.0
  Downloading markdown2-2.4.6-py2.py3-none-any.whl (37 kB)
Installing collected packages: markdown2, codext
  DEPRECATION: codext is being installed using the legacy 'setup.py install' method, because it does not have a 'pyproject.toml' and the 'wheel' package is not installed. pip 23.1 will enforce this behaviour change. A possible replacement is to enable the '--use-pep517' option. Discussion can be found at https://github.com/pypa/pip/issues/8559
  Running setup.py install for codext ... done
Successfully installed codext-1.14.0 markdown2-2.4.6
    opened by mikeatlas 0
Releases(1.10.1)
Owner
Alex
I'm a security professional, passionate about programming (especially Python) and cyber security.
Alex
GitHub Repository
Albert launcher extension for converting units of length, mass, speed, temperature, time, current, luminosity, printing measurements, molecular substance, and more

unit-converter-albert-ext Extension for converting units of length, mass, speed, temperature, time, current, luminosity, printing measurements, molecu

Jonah Lawrence 2 Jan 13, 2022
Notion-cli-list-manager - A simple command-line tool for managing Notion databases

A simple command-line tool for managing Notion List databases. ✨

Giacomo Salici 75 Dec 04, 2022
Tools crack instagram + fb ayok dicoba keburu premium 😁

FITUR INSTALLASI [1] pkg update && pkg upgrade [2] pkg install git [3] pkg install python [4] pkg install python2 [5] pkg install nano [6]

Jeeck 1 Dec 11, 2021
A CLI application for storing contacts as a csv file written in Python.

Contacter A CLI application for storing contacts as a csv file written in Python. You can use this to save your contacts with a special relations tag

nostalgicnerdpenguin 1 Oct 23, 2021
A simple python script to execute a command when a YubiKey is disconnected

YubiKeyExecute A python script to execute a command when a YubiKey / YubiKeys are disconnected. β€β€β€Ž β€Ž How to use: 1. Download the latest release and d

6 Mar 12, 2022
Present - A terminal-based presentation tool with colors and effects.

present A terminal-based presentation tool with colors and effects. You can also play a codio (pre-recorded code block) on a slide. present is built o

Vinayak Mehta 4.2k Jan 03, 2023
Booky - A command line utility for bookmarking files on your terminal!

Booky A command line utility for bookmarking files for quick access With it you can: Bookmark and delete your (aliases of) files at demand Launch them

Pran 1 Sep 11, 2022
A command line application, written in Python, for interacting with Spotify.

spotify-py-cli A command line application, written in Python, for interacting with Spotify. The primary purpose behind developing this app was to gain

Drew Loukusa 0 Oct 07, 2021
Ros command - Unifying the ROS command line tools

Unifying the ROS command line tools One impairment to ROS 2 adoption is that all

37 Dec 15, 2022
Runs a command in P4wnP1 and displays the output on OLED screen (SH1106)

p4wnp1-oled-terminal Runs a command in P4wnP1 and displays the output on OLED screen (SH1106) Works on Raspberry Pi Zero 2 W Tested successfully on RP

PawnSolo 1 Dec 14, 2021
Convert ACSM files to DRM-free EPUB files with one command on Linux

Knock Convert ACSM files to DRM-free EPUB files using one command. This software does not utilize Adobe Digital Editions nor Wine. It is completely fr

Benton Edmondson 622 Dec 09, 2022
Juniper Command System is a Micro CLI Tool that allows you to manage your files, launch applications, as well as providing extra tools for OS Management.

Juniper Command System is a Micro CLI Tool that allows you to manage your files, launch applications, as well as providing extra tools for OS Management.

Juan Carlos JuΓ‘rez 1 Feb 02, 2022
moviepy-cli: Command line interface for MoviePy.

Moviepy-cli is designed to apply several video editing in a single command with Moviepy as an alternative to Video-cli.

Kentaro Wada 23 Jun 29, 2022
CryptoCo-py is a Python CLI application that uses CoinGecko API to allow the user to query cryptocurrency information by typing simple commands.

CryptoCo-py is a Python CLI application that uses CoinGecko API to allow the user to query cryptocurrency information by typing simple com

1 Jan 10, 2022
Autosub - Command-line utility for auto-generating subtitles for any video file

Auto-generated subtitles for any video Autosub is a utility for automatic speech recognition and subtitle generation. It takes a video or an a

Anastasis Germanidis 3.9k Jan 05, 2023
A python CLI app that converts a mp4 file into a gif with ASCII effect added.

Video2ASCIIgif This CLI app takes in a mp4 format video, converts it to a gif with ASCII effect applied. This also includes full control over: backgro

Sriram R 6 Dec 31, 2021
RSS reader client for CLI (Command Line Interface),

rReader is RSS reader client for CLI(Command Line Interface)

Lee JunHaeng 10 Dec 24, 2022
CLI program that allows you to change your Alacritty config with one command without editing the config file.

Pycritty Change your alacritty config on the fly! Installation: pip install pycritty By default, only the program itself will be installed, but you ca

Antonio Sarosi 184 Jan 07, 2023
Custom 64 bit shellcode encoder that evades detection and removes some common badchars (\x00\x0a\x0d\x20)

x64-shellcode-encoder Custom 64 bit shellcode encoder that evades detection and removes some common badchars (\x00\x0a\x0d\x20) Usage Using a generato

Cole Houston 2 Jan 26, 2022
Command Line Manager + Interactive Shell for Python Projects

Manage Command Line Manager + Interactive Shell for Python Projects

Python Manage 123 Aug 28, 2022