AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]] 

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 ">
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 ">
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)
  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
Template for a Dataflow Flex Template in Python

Dataflow Flex Template in Python This repository contains a template for a Dataflow Flex Template written in Python that can easily be used to build D

STOIX 5 Apr 28, 2022
Dbt-core - dbt enables data analysts and engineers to transform their data using the same practices that software engineers use to build applications.

Dbt-core - dbt enables data analysts and engineers to transform their data using the same practices that software engineers use to build applications.

dbt Labs 6.3k Jan 08, 2023
A utility for functional piping in Python that allows you to access any function in any scope as a partial.

WithPartial Introduction WithPartial is a simple utility for functional piping in Python. The package exposes a context manager (used with with) calle

Michael Milton 1 Oct 26, 2021
Jupyter notebooks for the book "The Elements of Statistical Learning".

This repository contains Jupyter notebooks implementing the algorithms found in the book and summary of the textbook.

Madiyar 369 Dec 30, 2022
A tax calculator for stocks and dividends activities.

Revolut Stocks calculator for Bulgarian National Revenue Agency Information Processing and calculating the required information about stock possession

Doino Gretchenliev 200 Oct 25, 2022
talkbox is a scikit for signal/speech processing, to extend scipy capabilities in that domain.

talkbox is a scikit for signal/speech processing, to extend scipy capabilities in that domain.

David Cournapeau 76 Nov 30, 2022
Finding project directories in Python (data science) projects, just like there R rprojroot and here packages

Find relative paths from a project root directory Finding project directories in Python (data science) projects, just like there R here and rprojroot

Daniel Chen 102 Nov 16, 2022
Python utility to extract differences between two pandas dataframes.

Python utility to extract differences between two pandas dataframes.

Jaime Valero 8 Jan 07, 2023
Containerized Demo of Apache Spark MLlib on a Data Lakehouse (2022)

Spark-DeltaLake-Demo Reliable, Scalable Machine Learning (2022) This project was completed in an attempt to become better acquainted with the latest b

8 Mar 21, 2022
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

Najibulloh Asror 2 Feb 10, 2022
An interactive grid for sorting, filtering, and editing DataFrames in Jupyter notebooks

qgrid Qgrid is a Jupyter notebook widget which uses SlickGrid to render pandas DataFrames within a Jupyter notebook. This allows you to explore your D

Quantopian, Inc. 2.9k Jan 08, 2023
High Dimensional Portfolio Selection with Cardinality Constraints

High-Dimensional Portfolio Selecton with Cardinality Constraints This repo contains code for perform proximal gradient descent to solve sample average

Du Jinhong 2 Mar 22, 2022
Karate Club: An API Oriented Open-source Python Framework for Unsupervised Learning on Graphs (CIKM 2020)

Karate Club is an unsupervised machine learning extension library for NetworkX. Please look at the Documentation, relevant Paper, Promo Video, and Ext

Benedek Rozemberczki 1.8k Jan 09, 2023
Approximate Nearest Neighbor Search for Sparse Data in Python!

Approximate Nearest Neighbor Search for Sparse Data in Python! This library is well suited to finding nearest neighbors in sparse, high dimensional spaces (like text documents).

Meta Research 906 Jan 01, 2023
Vaex library for Big Data Analytics of an Airline dataset

Vaex-Big-Data-Analytics-for-Airline-data A Python notebook (ipynb) created in Jupyter Notebook, which utilizes the Vaex library for Big Data Analytics

Nikolas Petrou 1 Feb 13, 2022
Stitch together Nanopore tiled amplicon data without polishing a reference

Stitch together Nanopore tiled amplicon data using a reference guided approach Tiled amplicon data, like those produced from primers designed with pri

Amanda Warr 14 Aug 30, 2022
Retentioneering 581 Jan 07, 2023
Desafio proposto pela IGTI em seu bootcamp de Cloud Data Engineer

Desafio Modulo 4 - Cloud Data Engineer Bootcamp - IGTI Objetivos Criar infraestrutura como código Utuilizando um cluster Kubernetes na Azure Ingestão

Otacilio Filho 4 Jan 23, 2022
Average time per match by division

HW_02 Unzip matches.rar to access .json files for matches. Get an API key to access their data at: https://developer.riotgames.com/ Average time per m

11 Jan 07, 2022
CubingB is a timer/analyzer for speedsolving Rubik's cubes, with smart cube support

CubingB is a timer/analyzer for speedsolving Rubik's cubes (and related puzzles). It focuses on supporting "smart cubes" (i.e. bluetooth cubes) for recording the exact moves of a solve in real time.

Zach Wegner 5 Sep 18, 2022