AptaMAT
Purpose
AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.
The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.
Dependencies
AptaMat have been written in Python 3.8+
Two Python modules are needed :
These can be installed by typing in the command prompt either :
./setup
or
pip install numpy
pip install scipy
Use of Anaconda is highly recommended.
Usage
AptaMat is a flexible Python script which can take several arguments:
structuresfollowed by secondary structures written in dotbracket formatfilesfollowed by path to formatted files containing one, or several secondary structures in dotbracket format
Both structures and files are independent functions in the script and cannot be called at the same time.
usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]
The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.
usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]
The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.
usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]
The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:
>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))
Examples
structures function
First introducing a simple example with 2 structures:
$ AptaMat.py -structures "(((...)))" "((.....))"
(((...)))
((.....))
> AptaMat : 0.08
Then, it is possible to input several structures:
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
(((...)))
((.....))
> AptaMat : 0.08
(((...)))
.(.....).
> AptaMat : 0.2
(((...)))
(.......)
> AptaMat : 0.3
files function
Taking the above file example:
$ AptaMat.py -files example.fa
5HRU
Template - Compared
((((.........(((((.....)))))))))
.........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605
Note
Compared structures need to have the same length as the Template structure.
For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.
The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.
1 Dec 9, 2021
10 Dec 8, 2022
79 Sep 20, 2022
2 Jul 22, 2022
1 Oct 26, 2021
2 Feb 10, 2022
1 Dec 10, 2021
0 Jan 26, 2022
7 Dec 15, 2022
50 Jan 05, 2023
2 Sep 01, 2022
20 Dec 26, 2022
13 Dec 15, 2022
2 Jan 20, 2022
3 Mar 07, 2022
3 Feb 12, 2022
0 Jan 20, 2022
2 Dec 22, 2021
3 Jun 30, 2022
1 Dec 26, 2021
71 Nov 05, 2022
65 Dec 09, 2022
7.7k Dec 30, 2022
2 Nov 18, 2021
14 Jan 02, 2023
88 Dec 06, 2022
791 Jan 04, 2023
1 Oct 02, 2022